Rous sarcoma virus genome is terminally redundant: the 3' sequence.
نویسندگان
چکیده
A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.
منابع مشابه
Rous sarcoma virus genome is terminally redundant: the 5' sequence.
When Rous sarcoma virus RNA is transcribed into DNA by the reverse transcriptase, a tRNA primer is elongated into DNA. The primer is near the 5' end of the virus genome; the first major DNA made is a "run-off" product extending 101 bases from the primer to the 5' end of the template. We have studied this DNA molecule to determine the sequence of the first 101 bases at the 5' end of the Rous sar...
متن کاملNucleotide sequence relationships between the genomes of an endogenous and an exogenous avian tumor virus.
We have used mapping of large T1 oligonucleotides to examine the genome of Rous-associated virus-O (RAV-O), an endogenous virus of chickens, and to compare it with that of Prague strain Rous sarcoma virus, subgroup B, (Pr-RSV-B), an exogenous sarcoma virus. To extend the sensitivity of such comparisons, we have developed a system of nucleic acid hybridization and hybridization-competition combi...
متن کاملTerminal redundancy and the origin of replication of Rous sarcoma virus RNA.
In vitro synthesis of Rous sarcoma virus DNA by the virion endogenous DNA polymerase activity is initiated on a tRNAtrp primer located near the 5' end of the genome. A major product of such synthesis is a piece of DNA 101 nucleotides long (strong stop DNA) which can be isolated covalently bound to the tRNA primer. Here we show that the strong stop DNA is complementary to the extreme 5' end of t...
متن کاملTerminally repeated sequences in the avian sarcoma virus RNA genome.
The initiation of DNA synthesis in vitro by RNA-directed DNA polymerase (deoxynucleosidetriphosphate: DNA deoxynucleotidyltransferase, EC 2.7.7.7) of avian oncornaviruses requires a tRNAtrp primer molecule located close to the 5' end of the viral RNA genome. DNA transcripts, 100 nucleotides in length, initiated on the tRNAtrp primer molecule contain nucleotide sequences complementary to a large...
متن کاملThe Classic: Integration of Deoxyribonucleic Acid Specific for Rous Sarcoma Virus after Infection of Permissive and Nonpermissive Hosts
A relatively simple but stringent technique was developed to detect the integration of virus-specific DNA into the genomes of higher organisms. In both permissive (duck) and nonpermissive (mammalian) cells which normally contain no nucleotide sequences specific for Rous sarcoma virus, transformation by the virus results in the appearance of DNA specific for Rous sarcoma virus covalently integra...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Proceedings of the National Academy of Sciences of the United States of America
دوره 74 3 شماره
صفحات -
تاریخ انتشار 1977